| Gene name |
SPBC8D2.06 |
| Gene ID |
48/A03 |
| Gene synonyms/obsolete |
|
| Gene product |
isoleucyl-tRNA
synthetase, cytoplasmic isoleucine-tRNA ligase; involved in
isoleucyl-tRNA aminoacylation; isoleucine-tRNA ligase
activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3195 |
| ORF length (spliced) |
|
| Entry clone length |
3195 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1671T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC8D2.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTTTAACGTTCCTAA |
| Rev primer name |
SPBC8D2.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGCCTAAGAAGACTGAGA |
| Amino acid length |
1064 |
| Molecular weight |
122.9 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
897 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYTVVPQLLGL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Leica |