| Gene name |
SPBC1198.04c |
| Gene ID |
47/G09 |
| Gene synonyms/obsolete |
zas1 |
| Gene product |
zinc finger protein;
zf-C2H2 type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3053 |
| ORF length (spliced) |
2694 |
| Entry clone length |
3053 |
| No. of intron |
8 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1198.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAATGAGGAATCTTT |
| Rev primer name |
SPBC1198.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATTTCCCTTGGATAAT |
| Amino acid length |
897 |
| Molecular weight |
102.8 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |