Gene name |
SPAC8F11.03 |
Gene ID |
47/G08 |
Gene synonyms/obsolete |
swi4 |
Gene product |
MutS family; involved
in mating-type determination |
Entry clone |
Cloned |
ORF length (unspliced) |
3050 |
ORF length (spliced) |
3015 |
Entry clone length |
3050 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC8F11.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAGGAATGAGTTATAA |
Rev primer name |
SPAC8F11.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGATTTCTTCGAAAGCGGTA |
Amino acid length |
1004 |
Molecular weight |
114.6 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
71/72 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |