| Gene name |
SPAC22F3.03c |
| Gene ID |
47/G07 |
| Gene synonyms/obsolete |
|
| Gene product |
DEAD/DEAH box
helicase; SNF2 family; helicase C-terminal domain; involved in
DNA repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3040 |
| ORF length (spliced) |
2307 |
| Entry clone length |
3040 |
| No. of intron |
14 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC22F3.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACGAAGAGCTACTTT |
| Rev primer name |
SPAC22F3.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGAACTTTTTATGCATT |
| Amino acid length |
768 |
| Molecular weight |
87.8 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LELIELFLSI |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |