Gene name |
SPBC1215.02c |
Gene ID |
47/F05 |
Gene synonyms/obsolete |
|
Gene product |
N-acetyltransferase
complex (non catalytic subunit); interacts physically with
SPCC16C4.12; actin-binding protein; involved in mitochondrial
inheritance; involved in mitochondrial biogenesis; involved in
actin cytoskeletal organization; involved in excluding cofilin
from cytoplasmic actin cables; TPR repeat protein (inferred
from context); involved in cell polarity |
Entry clone |
Cloned |
ORF length (unspliced) |
2972 |
ORF length (spliced) |
2436 |
Entry clone length |
2972 |
No. of intron |
7 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1215.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTCGTTCTGGGAGTAA |
Rev primer name |
SPBC1215.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATTTTACAAATTTTGGA |
Amino acid length |
811 |
Molecular weight |
92.4 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWVISSLYL/LYAEVLLLKI/LKLPLIRLYL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |