Gene name |
SPAC31A2.14 |
Gene ID |
47/F04 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein;
similar to Sp SPCC16A11.02 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
2966 |
ORF length (spliced) |
2889 |
Entry clone length |
2966 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC31A2.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGTTCGGAAACGGTA |
Rev primer name |
SPAC31A2.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATATTAAGACTCTGGGTT |
Amino acid length |
962 |
Molecular weight |
107.2 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; periphery at
site of septum formation and cell tip |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol ) |
Microscope used for
observation |
Leica |