Gene name |
SPAC23C4.19 |
Gene ID |
47/F06 |
Gene synonyms/obsolete |
spt5 |
Gene product |
involved in
transcriptional regulation; involved in chromatin remodeling;
nonopeptide repeat TPAWNSGSK -necessary and sufficient for
binding to the capping enzymes in vivo (in a 2-hybrid assay)
and in vitro; involved in tranS. cerevisiaeription
elongation (regulation); involved in RNA polymerase II
processivity (regulation) (implicated); chromatin structural
protein; essential |
Entry clone |
Cloned |
ORF length (unspliced) |
2973 |
ORF length (spliced) |
|
Entry clone length |
2973 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC23C4.19.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACGAATTCTCCGAA |
Rev primer name |
SPAC23C4.19.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGAGAAGGAGGTACATAT |
Amino acid length |
990 |
Molecular weight |
109 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; spindle
microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |