Gene name |
SPAC17G6.12 |
Gene ID |
47/B10 |
Gene synonyms/obsolete |
pcu1 |
Gene product |
cullin family; SCF
ubiquitin ligase complex; covalent modification of cullin-1 by
the NEDD8 system plays an essential role in the function of
SCF |
Entry clone |
Cloned |
ORF length (unspliced) |
2760 |
ORF length (spliced) |
2304 |
Entry clone length |
2760 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17G6.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTACTTTGAATACCAA |
Rev primer name |
SPAC17G6.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAAGGTAAATGTATTCA |
Amino acid length |
767 |
Molecular weight |
89.4 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGEALYNNLVL/LVYDIYTLCL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |