| Gene name |
SPCC1672.06c |
| Gene ID |
47/B11 |
| Gene synonyms/obsolete |
asp1 |
| Gene product |
acid phosphatase;
important for the function of the cortical actin cytoskeleton;
deletion mutant results in altered morphology and growth
properties at elevated temperatures; deletion mutant results
in polarized growth defects; non-essential; synthetically
lethal with mutations in Arp2/3 complex components |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2763 |
| ORF length (spliced) |
|
| Entry clone length |
2763 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1672.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCAAAATGCAAGTCA |
| Rev primer name |
SPCC1672.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTAATGTTAACAGGAATA |
| Amino acid length |
920 |
| Molecular weight |
105.6 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGEQFHKDLYI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |