Gene name |
SPAC1F7.05 |
Gene ID |
47/B09 |
Gene synonyms/obsolete |
cdc22 |
Gene product |
ribonucleoside
reductase; ribonucleoside-diphosphate reductase (large
subunit); involved in DNA; replication (initiation); involved
in meiosis; essential; involved in DNA replication (required);
expressed at G1-S phase; regulated by DSC1/MBF complex |
Entry clone |
Cloned |
ORF length (unspliced) |
2752 |
ORF length (spliced) |
2436 |
Entry clone length |
2752 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1F7.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGTATACAAAAGAGG |
Rev primer name |
SPAC1F7.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGCTGAGCACATTTCGCAA |
Amino acid length |
811 |
Molecular weight |
91.9 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LADAFFALRL |
Localization (YFP) |
cytosol |
Comments for localization |
bright dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |