Gene name |
SPAC9G1.06c |
Gene ID |
47/B08 |
Gene synonyms/obsolete |
cyk3 |
Gene product |
src (SH3) homology
domain; involved in cytokinesis; non-essential |
Entry clone |
Cloned# |
ORF length (unspliced) |
2744 |
ORF length (spliced) |
2661 |
Entry clone length |
2744 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC9G1.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCATTCCTAAACAACT |
Rev primer name |
SPAC9G1.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACCGCCTGCCAGGTTGCA |
Amino acid length |
886 |
Molecular weight |
98.2 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNSLGSSLSL/LVKEMLQALDL/LNDLEVLQI |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
whole periphery by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |