Gene name |
SPCC24B10.01 |
Gene ID |
47/B07 |
Gene synonyms/obsolete |
cdc21; mcm4;
SPCC16A11.17 |
Gene product |
MCM complex subunit;
involved in DNA replication (initiation) (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
2736 |
ORF length (spliced) |
|
Entry clone length |
2736 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC24B10.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTCTAGTCAGCAAAG |
Rev primer name |
SPCC24B10.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGTCTGTGCAATTGAA |
Amino acid length |
911 |
Molecular weight |
101.5 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
443 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LISIKGLVL |
Localization (YFP) |
no transformant |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|