Gene name |
SPBC6B1.07 |
Gene ID |
47/B06 |
Gene synonyms/obsolete |
zer1; prp1 |
Gene product |
TPR repeat protein;
involved in mRNA splicing (IGI); involved in G0 transition;
involved in cell cycle progression (implicated); involved in
poly(A)+ RNA nuclear export (implicated); does not
functionally complement Sc PRP6 |
Entry clone |
Cloned |
ORF length (unspliced) |
2721 |
ORF length (spliced) |
|
Entry clone length |
2721 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC6B1.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAACTTTTATCCAGA |
Rev primer name |
SPBC6B1.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAACACATTTATGGCAAGA |
Amino acid length |
906 |
Molecular weight |
103 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIPMSIDLWL/LQLLENALKI/LLCTIARMLWL |
Localization (YFP) |
nucleus |
Comments for localization |
one nuclear dot by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |