Gene name |
SPAC3H1.09c |
Gene ID |
46/E10 |
Gene synonyms/obsolete |
|
Gene product |
amino acid transporter
|
Entry clone |
Cloned |
ORF length (unspliced) |
2123 |
ORF length (spliced) |
1971 |
Entry clone length |
2123 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
1894T:addition |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC3H1.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAATAGTCAGTCTAT |
Rev primer name |
SPAC3H1.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAAAATGTCATGTACGTA |
Amino acid length |
656 |
Molecular weight |
73 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
568 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSHICFLLLI/LIADVFILLGI/LRVLIVILAI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |