| Gene name |
SPAC105.03c |
| Gene ID |
46/E11 |
| Gene synonyms/obsolete |
|
| Gene product |
putative
transcriptional activator; possible activator for allantoin,
4-aminobutyric acid (GABA), and urea catabolic genes; zinc
finger protein (201others); zf-fungal Zn(2)-Cys(6) binuclear
cluster domain; similar to Sp SPAC25B8.11 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2127 |
| ORF length (spliced) |
|
| Entry clone length |
2127 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC105.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCAAAGTTCATCTCC |
| Rev primer name |
SPAC105.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTCAGGGTTTCGTCCAAG |
| Amino acid length |
708 |
| Molecular weight |
80.9 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFLQIDALEL |
| Localization (YFP) |
periphery;
vacuole |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |