Gene name |
SPCC4B3.03c |
Gene ID |
46/D05 |
Gene synonyms/obsolete |
|
Gene product |
conserved hypothetical
protein; involved in mitochondrial maintenance; CBS domain
protein; DUF21 |
Entry clone |
Cloned |
ORF length (unspliced) |
2040 |
ORF length (spliced) |
|
Entry clone length |
2040 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
772A:G / 1432T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC4B3.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCCTATTGAGAATTCG |
Rev primer name |
SPCC4B3.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTCTTGCTTTTACCTTTT |
Amino acid length |
679 |
Molecular weight |
74.3 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
668 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGGVFAGLTI/LVTLHRDLGI |
Localization (YFP) |
Golgi; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |