Gene name |
SPBC1105.08 |
Gene ID |
46/D04 |
Gene synonyms/obsolete |
|
Gene product |
putative transmembrane
protein EMP70 family |
Entry clone |
Cloned |
ORF length (unspliced) |
2038 |
ORF length (spliced) |
1890 |
Entry clone length |
2038 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1105.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTTACCTAGTATTCC |
Rev primer name |
SPBC1105.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAATTTTAATGGACGCA |
Amino acid length |
629 |
Molecular weight |
71.1 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
9 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi; vacuole
membrane by over expression |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |