| Gene name |
SPAC1834.07 |
| Gene ID |
46/D06 |
| Gene synonyms/obsolete |
krp1; klp3 |
| Gene product |
kinesin-like protein;
affects golgi membrane recycling; overexpression inhibits
mitotic growth; overexpression results in aberrant septa;
interacts physically with Kap1p; involved in cytokinesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2044 |
| ORF length (spliced) |
1665 |
| Entry clone length |
2044 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1834.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCAATTAAAGTAGT |
| Rev primer name |
SPAC1834.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTGCCCCCTTGAATTTTC |
| Amino acid length |
554 |
| Molecular weight |
61.9 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
large bright dots;
small cytoplasmic dots at periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |