| Gene name |
SPAC14C4.03 |
| Gene ID |
44/F05 |
| Gene synonyms/obsolete |
mek1 |
| Gene product |
serine/threonine
protein kinase; FHA domain (phosphopeptide binding);
Cds1/Rad53/Chk2 family; meiosis-specific kinase; involved in
meiosis; involved in meiotic recombination (regulation);
involved in meiotic recombination checkpoint; phosphorylates
Cdc2p (Tyr-15) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1427 |
| ORF length (spliced) |
1338 |
| Entry clone length |
1427 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC14C4.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTTTTTATCACATGC |
| Rev primer name |
SPAC14C4.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGCCGGGAATGTTTAAGA |
| Amino acid length |
445 |
| Molecular weight |
51.1 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGVIMFLLL |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |