Gene name |
SPCC622.14 |
Gene ID |
44/F04 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-GCS type; putative ADP-ribosylation factor;
GTPase-activating protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1425 |
ORF length (spliced) |
930 |
Entry clone length |
1425 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC622.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTATAAATTAGACCA |
Rev primer name |
SPCC622.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCGTGCTTATCGAAATTC |
Amino acid length |
309 |
Molecular weight |
34.1 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots,
especially at cell tip and site of septum formation |
Comments for localization |
accumulated
localization by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |