| Gene name |
SPBC365.02c |
| Gene ID |
43/H07 |
| Gene synonyms/obsolete |
cox10 |
| Gene product |
involved in cytochrome
c oxidase biogenesis; heme farnesyl transferase; involved in
heme A synthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1164 |
| ORF length (spliced) |
|
| Entry clone length |
1164 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC365.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCATATACTAAACAA |
| Rev primer name |
SPBC365.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATATTTCAATGTATCCTCC |
| Amino acid length |
387 |
| Molecular weight |
43.1 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRYALAFLPL/LHLPLLFTLTL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |