| Gene name |
SPCC330.10 |
| Gene ID |
43/H08 |
| Gene synonyms/obsolete |
pcm1 |
| Gene product |
mRNA capping
methyltransferase; methylates the terminal guanine residue of
the mRNA cap |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1170 |
| ORF length (spliced) |
|
| Entry clone length |
1170 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC330.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAGTCATCATATGAT |
| Rev primer name |
SPCC330.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTCCCCTCTTCTCAAAG |
| Amino acid length |
389 |
| Molecular weight |
45 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIWVKPFLDI |
| Localization (YFP) |
periphery at site of
septum formation; cytosol=nucleus |
| Comments for localization |
cytoplasmic dots by
over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |