Gene name |
SPCC1322.16 |
Gene ID |
43/H06 |
Gene synonyms/obsolete |
|
Gene product |
prohibitin; involved
in cell aging; involved in proteolysis |
Entry clone |
Cloned directly into
pDUAL-FFH1 |
ORF length (unspliced) |
1152 |
ORF length (spliced) |
840 |
Entry clone length |
1152 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1322.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATTTGATGAAGCG |
Rev primer name |
SPCC1322.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTAATATCATCTAAAAGT |
Amino acid length |
279 |
Molecular weight |
31.1 |
Isoelectric point (calc.) |
10.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|