Gene name |
SPAC24H6.05 |
Gene ID |
40/F12 |
Gene synonyms/obsolete |
cdc25; sal2 |
Gene product |
M-phase inducer
phosphatase; involved in G2/M phase transition; involved in
cell cycle checkpoint; involved in DNA damage checkpoint;
involved in DNA repair checkpoint; involved in the regulation
of CDK activity; involved in control of mitosis |
Entry clone |
Cloned |
ORF length (unspliced) |
1791 |
ORF length (spliced) |
|
Entry clone length |
1791 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
25T:C / 1557T:C /
1779T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC24H6.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTCCGCTTTCTTC |
Rev primer name |
SPAC24H6.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATCTTCTAAGTGTAGAG |
Amino acid length |
596 |
Molecular weight |
66.5 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
DeltaVision |