Gene name |
SPBC557.03c |
Gene ID |
40/G01 |
Gene synonyms/obsolete |
pim1; dcd1; ptr2 |
Gene product |
GDP/GTP exchange
factor (RanGEF); involved in mitotic checkpoint; involved in
metaphase-anaphase transition (required); regulates mitotic
checkpoint; regulates chromotin decondensation; involved in
nuclear export; regulates mRNA processing and transport;
poly(A)+ RNA transport protein; RCC repeats (7) |
Entry clone |
Cloned |
ORF length (unspliced) |
1795 |
ORF length (spliced) |
1620 |
Entry clone length |
1795 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
710T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC557.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCTAATAGAAGTAC |
Rev primer name |
SPBC557.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGTGGTGGAGCTGGGT |
Amino acid length |
539 |
Molecular weight |
58.3 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |