Gene name |
SPBC1652.02 |
Gene ID |
40/F11 |
Gene synonyms/obsolete |
aap1;
SPBC16A3.20c |
Gene product |
APC amino acid
transporter |
Entry clone |
Cloned |
ORF length (unspliced) |
1785 |
ORF length (spliced) |
|
Entry clone length |
1785 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
392A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1652.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCGTTTACGGAATC |
Rev primer name |
SPBC1652.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCAAAGGAAGTCGGCAACT |
Amino acid length |
594 |
Molecular weight |
65.2 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSAMILALIL |
Localization (YFP) |
ER |
Comments for localization |
accumulated ER by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |