Gene name |
SPBC14C8.07c |
Gene ID |
40/F10 |
Gene synonyms/obsolete |
cdc18 |
Gene product |
involved in DNA
replication (initiation); MCM loader; couples cell cycle
signals to DNA replication machinery; required to induce and
maintain the S-phase checkpoint; involved in the regulation of
CDK activity; involved in control of mitosis; DNA replication
checkpoint protein; expressed at G1-S phase; regulated by
DSC1/MBF complex |
Entry clone |
Cloned |
ORF length (unspliced) |
1734 |
ORF length (spliced) |
|
Entry clone length |
1734 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1476A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC14C8.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTGAAACTCCAATAGG |
Rev primer name |
SPBC14C8.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTTCTGTCAAAAAATCGT |
Amino acid length |
577 |
Molecular weight |
64.7 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
nucleus? |
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |