Gene name |
SPBC1734.02c |
Gene ID |
40/E06 |
Gene synonyms/obsolete |
cdc27;
SPBC337.18c |
Gene product |
DNA polymerase (delta
subunit); involved in G2/M phase transition (required);
interacts physically with Pcn1p; recruits PCNA to the Pol
delta holoenzyme; interacts physically with Cdc1p; essential;
involved in DNA replication (required); involved in telomere
maintenance |
Entry clone |
Cloned |
ORF length (unspliced) |
1408 |
ORF length (spliced) |
1119 |
Entry clone length |
1408 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
6G:deletion /
7G:deletion / 8A:deletion |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1734.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGAATGGAGAAACTT |
Rev primer name |
SPBC1734.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTCTTTCCAAAAAAGGAC |
Amino acid length |
372 |
Molecular weight |
42.3 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
294 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVTVDNLSL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |