| Gene name |
SPAC4D7.05 |
| Gene ID |
40/E05 |
| Gene synonyms/obsolete |
sum1; tif34 |
| Gene product |
translation initiation
factor 3 (eif3 subunit 2); WD repeat protein; overexpression
suppresses S/M checkpoint mutants; essential; involved in
translation initiation (required); inhibits osmotic stress
cell cycle; overexpression results in reduced global
translation; interacts physically with Int6p; interacts
physically with Mts2p; interacts physically with Mts4p;
colocalizes stably with the 26S proteasome at the nuclear
periphery; localization 26S proteasome dependent |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1398 |
| ORF length (spliced) |
987 |
| Entry clone length |
1398 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1017T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4D7.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGCCTATCATTTTACA |
| Rev primer name |
SPAC4D7.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAATGTATACTTGAAGTCA |
| Amino acid length |
328 |
| Molecular weight |
36.8 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |