| Gene name |
SPBC1773.14 |
| Gene ID |
40/E04 |
| Gene synonyms/obsolete |
arg7 |
| Gene product |
argininosuccinate
lyase; similar to Sp SPBC1539.03C (paralog) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1386 |
| ORF length (spliced) |
|
| Entry clone length |
1386 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1007C:A/ 1006G:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1773.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGAAAAATCAAGCAA |
| Rev primer name |
SPBC1773.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAATTGCTGATCGTATA |
| Amino acid length |
461 |
| Molecular weight |
51.7 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYTRVSQLPL/LGDMIGLMI/LTGVVSTLTI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |