Gene name |
SPBC1773.14 |
Gene ID |
40/E04 |
Gene synonyms/obsolete |
arg7 |
Gene product |
argininosuccinate
lyase; similar to Sp SPBC1539.03C (paralog) |
Entry clone |
Cloned# |
ORF length (unspliced) |
1386 |
ORF length (spliced) |
|
Entry clone length |
1386 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1007C:A/ 1006G:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1773.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGAAAAATCAAGCAA |
Rev primer name |
SPBC1773.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGAATTGCTGATCGTATA |
Amino acid length |
461 |
Molecular weight |
51.7 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYTRVSQLPL/LGDMIGLMI/LTGVVSTLTI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |