Gene name |
SPBC19C2.05 |
Gene ID |
40/E07 |
Gene synonyms/obsolete |
ran1; pat1 |
Gene product |
serine/threonine
protein kinase; involved in conjugation (regulation)
(negative); involved in meiosis (regulation) (negative);
involved in protein amino acid phosphorylation (of
Mei2p) |
Entry clone |
Cloned |
ORF length (unspliced) |
1413 |
ORF length (spliced) |
|
Entry clone length |
1413 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
464T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC19C2.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGCGCGAAAATCCAGA |
Rev primer name |
SPBC19C2.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAGCGATTTTCGAGATGGA |
Amino acid length |
470 |
Molecular weight |
52.2 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots;
nucleus>cytosol; cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |