Gene name |
SPAC11E3.01c |
Gene ID |
39/D03 |
Gene synonyms/obsolete |
SPAC2H10.03c |
Gene product |
putative Snf2 family
helicase SNF2 family; helicase C-terminal domain; similar to
human Snf2p homolog; involved in transcriptional regulation;
chromodomain-helicase-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
3867 |
ORF length (spliced) |
|
Entry clone length |
3867 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
3121A:G /
3161A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC11E3.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTACGAGGAGTCAGA |
Rev primer name |
SPAC11E3.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCATTCATCACTAGTTCCT |
Amino acid length |
1288 |
Molecular weight |
149.4 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
397/183 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |