| Gene name |
SPCC1235.05c |
| Gene ID |
39/D02 |
| Gene synonyms/obsolete |
|
| Gene product |
helicase with SNF2
domain DEAD/DEAH box helicase; SNF2 family; helicase
C-terminal domain; involved in UV protection; paralog? |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3855 |
| ORF length (spliced) |
|
| Entry clone length |
3855 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
162T:C / 163A:G /
793C:T / 1175A:G / 1593T:C / 3818A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1235.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCCTTACAATTCAAA |
| Rev primer name |
SPCC1235.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCTTTAGCAGCATTATTG |
| Amino acid length |
1284 |
| Molecular weight |
143.6 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVGVNWLHL/LFSQFTQMLDI/LEQVLDTLKI |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |