Gene name |
SPCC550.14 |
Gene ID |
39/D01 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical KH domain
RNA-binding protein RNA-binding protein; KH domain; involved
in control of mitotic chromosome transmission |
Entry clone |
Cloned |
ORF length (unspliced) |
3840 |
ORF length (spliced) |
|
Entry clone length |
3840 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
297A:T / 1125T:C /
1629G:A / 3502C:T / 3639T:C / 3671G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC550.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTCATATGATTTTCA |
Rev primer name |
SPCC550.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCTTGATTTTGGTTTTCT |
Amino acid length |
1279 |
Molecular weight |
141.2 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRTTIPTMLPI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |