| Gene name |
SPAC18B11.11 |
| Gene ID |
39/D04 |
| Gene synonyms/obsolete |
SPAC1F5.01 |
| Gene product |
hypothetical 149.2 kD
protein GTPase activating protein; similar to human tuberous
sclereosis 2; similar to Sp SPAC630.13c; putative Rap_GAp
domain (Pfam reduced threshold); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3885 |
| ORF length (spliced) |
|
| Entry clone length |
3885 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
371T:C / 851G:A /
3121A:G / 3161A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC18B11.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGGCTTTGGATATAGA |
| Rev primer name |
SPAC18B11.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGAAATAATGTGAAATCA |
| Amino acid length |
1294 |
| Molecular weight |
149.1 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LESSLYSSLII |
| Localization (YFP) |
nucleus>cytosol;
nuclear dots; periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |