| Gene name |
SPAC1250.01 |
| Gene ID |
39/B09 |
| Gene synonyms/obsolete |
SPAC29A4.21 |
| Gene product |
putative
transcriptional regulator chromatin remodeling complex;
involved in transcriptional activation; SNF2 family; helicase
C-terminal domain; DEAD/DEAH box helicase; bromodomain
protein; HSA domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3641 |
| ORF length (spliced) |
3600 |
| Entry clone length |
3641 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
280T:C / 866A:G /
2098A:G / 2397A:G / 2481G:A / 3474A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1250.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTGCAGAGAAGCAATA |
| Rev primer name |
SPAC1250.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCTCATTTTCAATTCTG |
| Amino acid length |
1199 |
| Molecular weight |
140 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVELKKLRL |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |