| Gene name |
SPAC10F6.09c |
| Gene ID |
39/B08 |
| Gene synonyms/obsolete |
psm3; smc3 |
| Gene product |
putative
chromosome-associated protein cohesin subunit; predicted
coiled-coil protein; SMC family; involved in sister chromatid
cohesion; smc1 dimerization partner; involved in DNA
repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3628 |
| ORF length (spliced) |
3585 |
| Entry clone length |
3628 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
135T:C / 1293A:G /
2805T:C / 2822T:C / 3037T:C / 3388C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC10F6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATATCACAAAAGTAAG |
| Rev primer name |
SPAC10F6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCTTCAACGAATGCCATA |
| Amino acid length |
1194 |
| Molecular weight |
136.8 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEYELNTNLYL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |