| Gene name |
SPAC6G9.06c |
| Gene ID |
39/B07 |
| Gene synonyms/obsolete |
pcp1 |
| Gene product |
pericentrin; coiled
coil protein; calmodulin binding; overexpression results in
the formation of supernumerary SPB-like structures and
disrupts both mitotic spindle assembly and chromosome
segregation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3627 |
| ORF length (spliced) |
|
| Entry clone length |
3627 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1253A:G /
2886G:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G9.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAACGAGATTTTAA |
| Rev primer name |
SPAC6G9.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAGTTTGCGGTCTTTGCC |
| Amino acid length |
1208 |
| Molecular weight |
140.7 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEKTIEDLKL |
| Localization (YFP) |
SPB |
| Comments for localization |
dispersed SPB by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |