| Gene name |
SPBC2F12.13 |
| Gene ID |
39/A05 |
| Gene synonyms/obsolete |
klp5 |
| Gene product |
kinesin-like protein;
kinesin family; microtubule-destabilizing Kin I family; KIP3
subfamily; involved in microtubule disassembly; involved in
meiosis (required); regulates the establishment of metaphase;
regulates the onset of anaphase A; deletion mutant results in
resistance to microtubule poison thiabendazole; deletion
mutant results in abnormally long cytoplasmic microtubules;
involved in chromosome segregation (mitosis); involved in
spindle kinetochore attachment; similar to Sp klp6 (paralog);
non-essential; transcriptionally regulated by Sep1; Ras1-Scd
pathway; similar to S. pombe klp6 |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
2708 |
| ORF length (spliced) |
2652 |
| Entry clone length |
2708 |
| No. of intron |
1 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC2F12.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAGACAGTCGTCCAT |
| Rev primer name |
SPBC2F12.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTGGCTTTCTCTTCTTCG |
| Amino acid length |
883 |
| Molecular weight |
99 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRMTFEETLPL/LSSLTTLHL |
| Localization (YFP) |
microtubules;
SPB |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |