Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPBC2F12.13
Gene ID 39/A05
Gene synonyms/obsolete klp5
Gene product kinesin-like protein; kinesin family; microtubule-destabilizing Kin I family; KIP3 subfamily; involved in microtubule disassembly; involved in meiosis (required); regulates the establishment of metaphase; regulates the onset of anaphase A; deletion mutant results in resistance to microtubule poison thiabendazole; deletion mutant results in abnormally long cytoplasmic microtubules; involved in chromosome segregation (mitosis); involved in spindle kinetochore attachment; similar to Sp klp6 (paralog); non-essential; transcriptionally regulated by Sep1; Ras1-Scd pathway; similar to S. pombe klp6
Entry clone Cloned in 2006 trial
ORF length (unspliced) 2708
ORF length (spliced) 2652
Entry clone length 2708
No. of intron 1
Sequence status Partially sequenced
Sequence results 100% match in both ends
Comments
Polymerase used for cloning Pyrobest DNA Pol (TaKaRa)
Fwd primer name SPBC2F12.13.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGTCAAGACAGTCGTCCAT
Rev primer name SPBC2F12.13.Rv
Rev primer SEQ AGAAAGCTGGGTAGGTGGCTTTCTCTTCTTCG
Amino acid length 883
Molecular weight 99
Isoelectric point (calc.) 7.9
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) LRMTFEETLPL/LSSLTTLHL
Localization (YFP) microtubules; SPB
Comments for localization
Effect of LMB on protein localization no change
Microscope used for observation DeltaVision

Image information
YFP 4 images) See all images

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.