Gene name |
SPAC824.05 |
Gene ID |
39/A06 |
Gene synonyms/obsolete |
vps16 |
Gene product |
vacuolar protein
sorting-associated protein involved in intracellular protein
transport; involved in vacuole fusion |
Entry clone |
Cloned |
ORF length (unspliced) |
2715 |
ORF length (spliced) |
2508 |
Entry clone length |
2715 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC824.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGCCTTCAATAAAGTA |
Rev primer name |
SPAC824.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCGGCGTAATTGATCAAGT |
Amino acid length |
835 |
Molecular weight |
95.1 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGDEIKLLQL |
Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |