Gene name |
SPAC24C9.06c |
Gene ID |
38/C07 |
Gene synonyms/obsolete |
|
Gene product |
aconitate hydratase;
involved in citrate metabolism; involved in glutamate
metabolism; involved in propionate metabolism; involved in
tricarboxylic acid cycle; aconitate hydratase activity |
Entry clone |
Cloned |
ORF length (unspliced) |
2337 |
ORF length (spliced) |
|
Entry clone length |
2337 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
460T:C / 1483A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC24C9.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCTCGCGTATTTTTAC |
Rev primer name |
SPAC24C9.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTTTGCTTGTGCATGTTT |
Amino acid length |
778 |
Molecular weight |
84.8 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |