| Gene name |
SPBC365.15 |
| Gene ID |
38/C08 |
| Gene synonyms/obsolete |
alp4 |
| Gene product |
spindle pole body
component; gamma tubulin complex; involved in G1 progression
(required); involved in spindle assembly checkpoint; involved
in cytokinesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2355 |
| ORF length (spliced) |
|
| Entry clone length |
2355 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
505A:G / 540T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC365.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGAGATCGATTAGTTC |
| Rev primer name |
SPBC365.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCCGTCAATTTCATTACT |
| Amino acid length |
784 |
| Molecular weight |
90.1 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCYKVPFPLSL |
| Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |