Gene name |
SPBC365.15 |
Gene ID |
38/C08 |
Gene synonyms/obsolete |
alp4 |
Gene product |
spindle pole body
component; gamma tubulin complex; involved in G1 progression
(required); involved in spindle assembly checkpoint; involved
in cytokinesis |
Entry clone |
Cloned |
ORF length (unspliced) |
2355 |
ORF length (spliced) |
|
Entry clone length |
2355 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
505A:G / 540T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC365.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGAGATCGATTAGTTC |
Rev primer name |
SPBC365.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCCGTCAATTTCATTACT |
Amino acid length |
784 |
Molecular weight |
90.1 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCYKVPFPLSL |
Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |