| Gene name |
SPAC1D4.12 |
| Gene ID |
38/C06 |
| Gene synonyms/obsolete |
rhp3; rad15 |
| Gene product |
transcription
initiation factor TFIIH subunit; involved in DNA repair
(required); involved in nucleotide-excision repair; DEAD/DEAH
box helicaseXP-D family; functionally complements Sc RAD3;
functionally complemented by Sc RAD3 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2319 |
| ORF length (spliced) |
|
| Entry clone length |
2319 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
174A:G / 1758T:A /
1879A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1D4.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTCTATATTGACGA |
| Rev primer name |
SPAC1D4.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTTCAACCACATCAATA |
| Amino acid length |
772 |
| Molecular weight |
88.1 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTSLVRALQI/LVAFFPSYLYL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
a few cytoplasmic dots
by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |