Gene name |
SPAC1D4.12 |
Gene ID |
38/C06 |
Gene synonyms/obsolete |
rhp3; rad15 |
Gene product |
transcription
initiation factor TFIIH subunit; involved in DNA repair
(required); involved in nucleotide-excision repair; DEAD/DEAH
box helicaseXP-D family; functionally complements Sc RAD3;
functionally complemented by Sc RAD3 |
Entry clone |
Cloned |
ORF length (unspliced) |
2319 |
ORF length (spliced) |
|
Entry clone length |
2319 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
174A:G / 1758T:A /
1879A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1D4.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTCTATATTGACGA |
Rev primer name |
SPAC1D4.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTTTCAACCACATCAATA |
Amino acid length |
772 |
Molecular weight |
88.1 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTSLVRALQI/LVAFFPSYLYL |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
a few cytoplasmic dots
by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |