| Gene name |
SPAC24H6.09 |
| Gene ID |
38/C05 |
| Gene synonyms/obsolete |
|
| Gene product |
RhoGEF; guanine
nucleotide exchange factor; interacts physically with Cdc42p;
regulates Cdc42p; involved in septation; involved in septum
formation; involved in cellular elongation; involved in
bipolar growth; predicted coiled-coil region; overexpression
suppresses orb6-25; overexpression suppresses orb2-34;
non-essential; involved in the Cdc42p-Shk1p-Orb6p signaling
cascade; double mutant gef1delta/scd1delta lethal; similar to
Sp SPBC29A3.17; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2317 |
| ORF length (spliced) |
2262 |
| Entry clone length |
2317 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
112A:G / 2061A:G /
2309A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24H6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGACTTTAAAAGCAGA |
| Rev primer name |
SPAC24H6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCCTCGCAGCTAAAGAG |
| Amino acid length |
753 |
| Molecular weight |
84.4 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIDPLPCNLGL/LQRLLKYPLLL |
| Localization (YFP) |
cytosol; periphery at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |