| Gene name |
SPAC13G7.01c |
| Gene ID |
38/C04 |
| Gene synonyms/obsolete |
erg7;
SPAC4G9.21c |
| Gene product |
lanosterol synthase
activity; involved in ergosterol biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2316 |
| ORF length (spliced) |
2166 |
| Entry clone length |
2316 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100T:C / 749T:C /
880T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13G7.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGCTTGCAGAGTCCG |
| Rev primer name |
SPAC13G7.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGGTCAGGTAATTGCCG |
| Amino acid length |
721 |
| Molecular weight |
82.8 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVDIPRLRL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Leica |