| Gene name |
SPBC19G7.01c |
| Gene ID |
38/A03 |
| Gene synonyms/obsolete |
msh2;
SPBC24C6.12c |
| Gene product |
mismatch-binding
protein; involved in DNA repair; involved in mismatch repair;
MMR pathway; interacts physically with Msh1p; interacts
physically with Msh6; involved in mating-type switching;
involved in chromosome organization (meiotic) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3086 |
| ORF length (spliced) |
2949 |
| Entry clone length |
3086 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
7T:C / 478G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19G7.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCTAGAAACGCTTC |
| Rev primer name |
SPBC19G7.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAGGAAACCTCATTTGTG |
| Amino acid length |
982 |
| Molecular weight |
109.7 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |