Gene name |
SPBC17G9.08c |
Gene ID |
38/A02 |
Gene synonyms/obsolete |
csx2 |
Gene product |
ADP-ribosylation
factor (ARF); GTPase activating protein; ArfGap domain;
pleckstrin homology domain; similar to Sp SPAC26A3.10; no
apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
2932 |
ORF length (spliced) |
2613 |
Entry clone length |
2932 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
447A:G / 631A:G /
2440A:G / 2906T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC17G9.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGGGCATGTCGATCC |
Rev primer name |
SPBC17G9.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGAGTTGCTCTATTCATC |
Amino acid length |
870 |
Molecular weight |
99 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGNVDPLPI/LKEAVLCLAL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |