| Gene name |
SPAC3H1.04c |
| Gene ID |
37/A01 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved fungal
protein |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1907 |
| ORF length (spliced) |
1806 |
| Entry clone length |
1907 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1684T:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3H1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCGAATCACGACTTGC |
| Rev primer name |
SPAC3H1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGAAATTACTGATTGAA |
| Amino acid length |
601 |
| Molecular weight |
69.4 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRFLHLVL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |