| Gene name |
SPBC2F12.14c |
| Gene ID |
37/A02 |
| Gene synonyms/obsolete |
gua1 |
| Gene product |
IMP dehydrogenase
activity; involved in purine biosynthesis; involved in guanine
biosynthesis; CBS domain protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1907 |
| ORF length (spliced) |
1575 |
| Entry clone length |
1907 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1056A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2F12.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCCTTTAAGCCTTA |
| Rev primer name |
SPBC2F12.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAAAGACGCTTTTCGTAT |
| Amino acid length |
524 |
| Molecular weight |
57 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |