Gene name |
SPAC4G8.12c |
Gene ID |
36/H12 |
Gene synonyms/obsolete |
|
Gene product |
PMP protein; involved
in GPI anchor biosynthesis (SGD); alpha-1,2
mannosyltransferase; involved in addition of the fourth,
side-branching mannose onto the GPI core structure (SGD) |
Entry clone |
Cloned |
ORF length (unspliced) |
1889 |
ORF length (spliced) |
1602 |
Entry clone length |
1889 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
36T:C / 942C:T /
1286T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4G8.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTAAAAACCGTAAATA |
Rev primer name |
SPAC4G8.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCCACACTTCTCAATACC |
Amino acid length |
533 |
Molecular weight |
62.2 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
7 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYMCLISLLI/LLPVFILSL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |